Skip directly to search Skip directly to A to Z list Skip directly to navigation Skip directly to page options Skip directly to site content

Protocol for emm typing

I. Lysate preparation

(Note that one can often simply boil very fresh growth with good results for DNA extracts).

1. DNAzol extraction of DNA

  1. Aliquot 50 µl of DNAzol per sample in tubes or in 96 well plate. Add 10 µL of STGG frozen culture (health, pure) or 1 µL loopful of bacterial colonies from fresh culture. Seal plate or tube.
  2. Vortex gently for 1 - 3 sec.
  3. Incubate at 80°C for 20 min.
  4. Proceed with PCR or store the DNA at -20°C, no heat inactivation required.

Note: Recommended to use 2 µL of template DNA for PCR.

2. Alternate protocol

  1. Pick fair amount 1/5 of fresh bacterial growth from the plate with standard loop (10 µL). Resuspend in 300 µL of 0.85% NaCl.
  2. Incubate at 70°C for 15 min.
  3. Centrifuge the samples at full speed for 2 min in microfuge and pipet out supernatant.
  4. Resuspend pellet in 50 µL TE (10mM Tris, 1mM EDTA, pH8), 10 µL Mutanolysin (3,000 U/mL), and 2 µL Hyaluronidase (30 mg/mL, Sigma H-3506; 300-750 U/mg).
  5. Vortex thoroughly and incubate at 37°C for 30 min.
  6. Then Incubate at 100°C for 10 min to inactivate the enzymes.
  7. Proceed with PCR or store the lysates at -20°C until use.

Occasionally we encounter isolates that are hard to amplify. In these cases we alter lysate preparation as follows:

  1. Pick fair amount 1/5 of fresh bacterial growth from the plate with standard loop (10 µL). Resuspend in 300 µL of 0.85% NaCl.
  2. Incubate at 70°C for 15 min.
  3. Centrifuge the samples at full speed for 2 min in microfuge and pipet out supernatant.
  4. Resuspend pellet in 50 µL TE (10mM Tris, 1mM EDTA, pH8), 10 µL Mutanolysin (3,000 U/mL), and 2 µL Hyaluronidase (30 mg/mL, Sigma H-3506; 300-750 U/mg).
  5. Vortex thoroughly and incubate at 37°C for 30 min.
  6. Then Incubate at 100°C for 10 min to inactivate the enzymes.
  7. Proceed with PCR or store the lysates at -20°C until use.
 Top of Page

II. PCR

PCR Primers

Primer 1TATT(C/G)GCTTAGAAAATTAA
Primer 2GCAAGTTCTTCAGCTTGTTT

PCR Master Mix

Reagentsper Reaction
10X buffer (with 15 mM MgCl2)2.5 µL
dNTPs (10 mM)0.5 µL
Primer 1 (70 pM/µL)0.5 µL
Primer 2 (70 pM/µL)0.5 µL
Taq Polymerase (3 U/µL)0.18 µL
dH2O19.82 µL
Total24 µL
  1. Spin down lysate at full speed for 1 min.
  2. For each sample, aliquot 24 µL master mix in PCR tubes/plate.
  3. Add no more than 1.0 µL lysate supernatant – vortex gently – centrifuge for few seconds to collect reaction mix at the bottom of the PCR tube/plate.
  4. Place the PCR reaction tubes/plate on thermocycler under the following conditions.

Note: Place the PCR plate on thermocycler only after the initial sample temperature (94°C) is reached.

94°C1 min1 cycle
94°C15 sec10 cycles
47°C30 sec10 cycles
72°C1 min 15 sec10 cycles
94°C15 sec20 cycles
47°C30 sec20 cycles
72°C1 min 15 sec with a 10 sec increment
for each of the subsequent 19 cycles		20 cycles
72°C7 min1 cycle
4°CHoldHold
 Top of Page

III. Sequencing

1. Purification of PCR reaction for sequencing

Prepare sequencing template from 2-11 µL aliquot of PCR product to be sequenced with ExoSAP-IT as follows:

PCR product5 µL
ExoSAP-IT2 µL
Total7 µL

Mix and incubate in a thermocycler using following conditions:

37°C15 min
80°C15 min

2. Sequence reaction

Sequencing primer: emmseq2 – TATTCGCTTAGAAAATTAAAAACAGG

Dilute BigDye V1.1 to 1:5 with the buffer provided with the kit.

Primer emm seq2 (3.2 pmole/µL)1 µL
Diluted BigDyeV1.1 (1:5)6 µL
dH2O12 µL
Purified PCR product1 µL
Total20 µL

For sequencing reaction, use the following cycling parameters:

96°C1 min 
96°C10 sec25 Cycles
55°C5 sec25 Cycles
60°C4 min25 Cycles
4°CHold

Store the sequencing reactions at -20°C until use.

Purify sequencing reactions using Agencourt's paramagnetic bead technology as described in CleanSEQ Reaction Clean-Up.

For consultation contact: Bernard Beall, Ph.D. email: BBeall@cdc.gov

 Top of Page
Top